SDHD Human qPCR Primer Pair (NM_003002)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SDHD (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), nuclear gene encoding mitochondrial protein
USD 150.00
Other products for "SDHD"
Specifications
Product Data | |
Gene ID | 6392 |
Forward Sequence | GCAGCACATACACTTGTCACCG |
Reverse Sequence | GGGAATAGTCCATCGCAGAGCA |
Accession No | NM_003002, NM_003002.1, NM_003002.2, NM_003002.3, BC009574, BC009574.1, BC005263, BC012603, BC015188, BC015992, BC022350, BC070307, BC071755, BC071756, BE567994, BF211358, BG492859, BQ000657, BQ932668, BT007238, BX419391, NM_003002.4 |
UniProt ID | O14521 |
Synonyms | CBT1; CII-4; CWS3; cybS; MC2DN3; PGL; PGL1; QPs3; SDH4 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.