RPS2 Human qPCR Primer Pair (NM_002952)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Other products for "RPS2"
Specifications
Product Data | |
Gene ID | 6187 |
Forward Sequence | CGATGACTGCTACACCTCAGCC |
Reverse Sequence | CTCCTGATAGGGAGACTTGGTG |
Accession No | NM_002952, NM_002952.1, NM_002952.2, NM_002952.3, BC066321, BC106060, BC001795, BC004520, BC006559, BC008329, BC008862, BC010165, BC012354, BC013833, BC016178, BC016951, BC018993, BC019021, BC020336, BC021545, BC023541, BC025677, BC029979, BC032129, BC035427, BC040830, BC052235, BC063011, BC068051, BC071673, BC071922, BC071923, BC071924, BC073966, BC075830, BC103756, BC105985 |
UniProt ID | P15880 |
Synonyms | LLREP3; S2 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.