NDUFB5 Human qPCR Primer Pair (NM_002492)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Rabbit Polyclonal antibody to NDUFB5 (NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa)
USD 625.00
Lenti ORF particles, NDUFB5 (Myc-DDK tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), nuclear gene encoding mitochondrial protein, transcript variant 1, 200ul, >10^7 TU/mL
USD 1,000.00
Other products for "NDUFB5"
Specifications
Product Data | |
Gene ID | 4711 |
Forward Sequence | AGGCTATGTCCCAGAACACTGG |
Reverse Sequence | CAGCTTCAATCTGAAGGACGGC |
Accession No | NM_002492, NM_002492.1, NM_002492.2, NM_002492.3, BC005271, BC009796, BC017909, BC093071, BG776403, BX648034, NM_002492.4 |
UniProt ID | O43674 |
Synonyms | CISGDH; SGDH |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.