OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATF 4 (ATF4) Human qPCR Primer Pair (NM_001675)

Be the first to review this product
SKU
HP205494
qSTAR qPCR primer pairs against Homo sapiens gene ATF4
  $150.00
3 Days*

Frequently Bought Together (4)

TA812797 ATF4 mouse monoclonal antibody, clone OTI1H9
100 ul
$447.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX. 4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RG222709 ATF4 (tGFP-tagged) - Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 1 10 ug
$886.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "ATF4 or NM_001675"

Specifications
Specifications
Product Data
Locus ID 468
Forward Sequence TTCTCCAGCGACAAGGCTAAGG
Reverse Sequence CTCCAACATCCAATCTGTCCCG
ACCN NM_001675, NM_001675.1, NM_001675.2, NM_001675.3, NM_001675.4, BC011994, BC011994.1, BC008090, BC016855, BC022088, BC024775, BC044895, BC073754, BC073990
UniProt ID P18848
Synonyms CREB-2; CREB2; TAXREB67; TXREB
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products