BRF1 Human qPCR Primer Pair (NM_001519)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (3)
BRF1 (Myc-DDK-tagged)-Human BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), transcript variant 1
USD 620.00
Other products for "BRF1"
Specifications
Product Data | |
Gene ID | 2972 |
Forward Sequence | AGAACCACGAGGTGTCCATGAC |
Reverse Sequence | CCACACTGATGACCTCCTTCAC |
Accession No | NM_001519, NM_001519.1, NM_001519.2, NM_001519.3, BC086856, BC016743, BC071637, BC103859, BC103860, BC103861, BC133655, BX440529, NM_001519.4 |
UniProt ID | Q92994 |
Synonyms | BRF; BRF-1; CFDS; GTF3B; hBRF; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.