Flt3 ligand (FLT3LG) Human qPCR Primer Pair (NM_001459)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
FLT3LG (Myc-DDK-tagged)-Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3
USD 300.00
Anti-FLT3LG (Flt3 ligand) mouse monoclonal antibody, clone OTI8D10 (formerly 8D10), Biotinylated
USD 509.00
Other products for "FLT3LG"
Specifications
Product Data | |
Gene ID | 2323 |
Forward Sequence | AGACTGTCGCTGGGTCCAAGAT |
Reverse Sequence | GGAGATGTTGGTCTGGACGAAG |
Accession No | NM_001459, NM_001459.1, NM_001459.2, NM_001459.3, BC126293, BC006331, BC011914, BC028001, BC136464, BC144129, NM_001459.4 |
UniProt ID | P49771 |
Synonyms | FL; FLG3L; FLT3L |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.