EEF1A1 Human qPCR Primer Pair (NM_001402)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Other products for "EEF1A1"
Specifications
Product Data | |
Gene ID | 1915 |
Forward Sequence | GATGGCAATGCCAGTGGAACCA |
Reverse Sequence | GAGAACACCAGTCTCCACTCGG |
Accession No | NM_001402, NM_001402.1, NM_001402.2, NM_001402.3, NM_001402.4, NM_001402.5, BC066893, BC066893.1, BC008587, BC009733, BC009875, BC010735, BC012509, BC012891, BC014224, BC014377, BC014892, BC018150, BC018641, BC018850, BC019050, BC019669, BC020477, BC021686, BC022412, BC028674, BC029337, BC029343, BC029997, BC035877, BC038339, BC038897, BC057391, BC063511, BC065761, BC066894, BC070131, BC070500, BC071619, BC071727, BC071741, BC071841, BC072385, BC082268, BC094687, BC111051, NM_001402.6 |
UniProt ID | P68104 |
Synonyms | CCS-3; CCS3; EE1A1; EEF-1; EEF1A; eEF1A-1; EF-Tu; EF1A; GRAF-1EF; LENG7; PTI1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.