BMPR2 Human qPCR Primer Pair (NM_001204)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
BMPR2 (Myc-DDK-tagged)-Human bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2)
USD 1,355.00
Other products for "BMPR2"
Specifications
Product Data | |
Gene ID | 659 |
Forward Sequence | AGAGACCCAAGTTCCCAGAAGC |
Reverse Sequence | CCTTTCCTCAGCACACTGTGCA |
Accession No | NM_001204, NM_001204.1, NM_001204.2, NM_001204.3, NM_001204.4, NM_001204.5, NM_001204.6, BC052985, BC052985.2, BC018743, BC032011, BC035097, BC041039, BC043650, BF063564, BG530017, BQ889263, BQ896556, BU176845, NM_001204.7 |
UniProt ID | Q13873 |
Synonyms | BMPR-II; BMPR3; BMR2; BRK-3; POVD1; PPH1; T-ALK |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.