beta Actin (ACTB) Human qPCR Primer Pair (NM_001101)

CAT#: HP204660

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene ACTB



USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 60
Forward Sequence CACCATTGGCAATGAGCGGTTC
Reverse Sequence AGGTCTTTGCGGATGTCCACGT
Accession No NM_001101, BC013380, BC001301, BC002409, BC004251, BC008633, BC009636, BC012854, BC013835, BC014401, BC014861, BC016045, BC023204, BC113036
Synonyms BRWS1; PS1TP5BP1
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (25)

Other products for "ACTB"
Frequently bought together (4)
beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control
    • 30 ul

USD 159.00


ACTB (Myc-DDK-tagged)-Human actin, beta (ACTB)
    • 10 ug

USD 420.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools