SULT1A1 Human qPCR Primer Pair (NM_001055)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1
USD 450.00
Other products for "SULT1A1"
Specifications
Product Data | |
Gene ID | 6817 |
Forward Sequence | GGAGTTCATGGACCACAGCATC |
Reverse Sequence | CCTGCCATCTTCTCCGCATAGT |
Accession No | NM_001055, NM_001055.1, NM_001055.2, NM_001055.3, BC000923, BC000923.2, BC110887, BC110887.1, BG482944, BG990719, BI459867, BI460081, BM927749, BM984308, BT007324 |
UniProt ID | P50225 |
Synonyms | HAST1/HAST2; P-PST; P-PST 1; PST; ST1A1; ST1A3; STP; STP1; ts-PST; TSPST1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.