REC114 Human qPCR Primer Pair (NM_001042367)

CAT#: HP203595

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene REC114

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 283677
Forward Sequence GGGCAACTGAAAGTCAAGGGAAG
Reverse Sequence CTAACTGCGTCAGTGAGGTCCT
Accession No NM_001042367, NM_001348772, BC055412, BX113903
Synonyms C15orf60; CT147
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "REC114"
Frequently bought together (1)
C15orf60 (Myc-DDK-tagged)-Human chromosome 15 open reading frame 60 (C15orf60)
    • 10 ug

USD 410.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones