RPL6 Human qPCR Primer Pair (NM_000970)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, RPL6 (mGFP-tagged) - Human ribosomal protein L6 (RPL6), transcript variant 1, 200ul, >10^7 TU/mL
USD 850.00
Other products for "RPL6"
Specifications
Product Data | |
Gene ID | 6128 |
Forward Sequence | CCTTGTCAGAGGAATTGGCAGG |
Reverse Sequence | GTAACAGTTGCGAGAACCTTCTC |
Accession No | NM_000970, NM_000970.1, NM_000970.2, NM_000970.3, NM_000970.4, BC004138, BC004138.2, BC022444, BC022444.1, BC104826, BC104826.1, BC013863, BC020679, BC031009, BC032299, BC070195, BC071912, BC104824, BG030827, BG722198, BP285025, BP308263, BU940020, NM_000970.5 |
UniProt ID | Q02878 |
Synonyms | L6; SHUJUN-2; TAXREB107; TXREB1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.