Cytochrome P450 2C9 (CYP2C9) Human qPCR Primer Pair (NM_000771)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
CYP2C9 (Cytochrome P450 2C9) mouse monoclonal antibody, clone OTI1D7 (formerly 1D7)
USD 447.00
CYP2C9 (Myc-DDK-tagged)-Human cytochrome P450, family 2, subfamily C, polypeptide 9 (CYP2C9)
USD 686.00
Other products for "CYP2C9"
Specifications
Product Data | |
Gene ID | 1559 |
Forward Sequence | CAGAGACGACAAGCACAACCCT |
Reverse Sequence | ATGTGGCTCCTGTCTTGCATGC |
Accession No | BC020754, NM_000771, NM_000771.1, NM_000771.2, NM_000771.3, BC020754.1, BC070317, BC125054, BJ993098, NM_000771.4 |
UniProt ID | P11712 |
Synonyms | CPC9; CYP2C; CYP2C10; CYPIIC9; P450IIC9 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.