Osteopontin (SPP1) Human qPCR Primer Pair (NM_000582)

CAT#: HP200549

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene SPP1



SensiMix SYBR Master Mix

USD 132.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 6696
Forward Sequence CGAGGTGATAGTGTGGTTTATGG
Reverse Sequence GCACCATTCAACTCCTCGCTTTC
Accession No BC017387, NM_000582, NM_001040058, NM_001040060, NM_001251829, NM_001251830, NM_001040058.1, NM_000582.1, NM_000582.2, NM_001040060.1, NM_001251829.1, NM_001251830.1, BC017387.1, BC022844, BC022844.1, BC093033, BC093033.1, BC007016, BF699765, BX648003, NM_001040058.2
UniProt ID P10451
Synonyms BNSP; BSPI; ETA-1; OPN
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "SPP1"
Frequently bought together (8)
SPP1 mouse monoclonal antibody, clone OTI5E4 (formerly 5E4)
    • 100 ul

USD 417.00


SPP1 (Myc-DDK tagged) - Homo sapiens secreted phosphoprotein 1 (SPP1), transcript variant 4
    • 10 ug

USD 477.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 154.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 484.00


SPP1 (Myc-DDK tagged) - Homo sapiens secreted phosphoprotein 1 (SPP1), transcript variant 5
    • 10 ug

USD 477.00


SPP1 (Myc-DDK-tagged)-Human secreted phosphoprotein 1 (SPP1), transcript variant 3
    • 10 ug

USD 477.00


SPP1 (Myc-DDK-tagged)-Human secreted phosphoprotein 1 (SPP1), transcript variant 2
    • 10 ug

USD 477.00


SPP1 (Myc-DDK-tagged)-Human secreted phosphoprotein 1 (SPP1), transcript variant 1
    • 10 ug

USD 477.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools