FISH (SH3PXD2A) Human Gene Knockout Kit (CRISPR)

CAT#: KN417487

Reviews ()
Write a review

SH3PXD2A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

KN2.0 knockout kit validation

  See Other Versions

KN417487 is the updated version of KN217487.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol SH3PXD2A
Locus ID 9644
Kit Components

KN417487G1, SH3PXD2A gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTGGCATCCTGCACGCAGT

KN417487G2, SH3PXD2A gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCACCTCCCAGACTATCTAC

KN417487D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_014631, NM_001365079
Synonyms FISH; SH3MD1; TKS5
Summary Adapter protein involved in invadopodia and podosome formation, extracellular matrix degradation and invasiveness of some cancer cells. Binds matrix metalloproteinases (ADAMs), NADPH oxidases (NOXs) and phosphoinositides. Acts as an organizer protein that allows NOX1- or NOX3-dependent reactive oxygen species (ROS) generation and ROS localization. In association with ADAM12, mediates the neurotoxic effect of amyloid-beta peptide. [UniProtKB/Swiss-Prot Function]


Other Versions

Other products for "SH3PXD2A"
Frequently bought together (2)
SH3PXD2A mouse monoclonal antibody,clone OTI1F5
    • 100 ul

USD 379.00

SH3PXD2A (Myc-DDK-tagged)-Human SH3 and PX domains 2A (SH3PXD2A)
    • 10 ug

USD 1,160.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools