Utrophin (UTRN) Human Gene Knockout Kit (CRISPR)

CAT#: KN413382

Reviews ()
Write a review

UTRN - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

KN2.0 knockout kit validation

  See Other Versions

KN413382 is the updated version of KN213382.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol UTRN
Locus ID 7402
Kit Components

KN413382G1, UTRN gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CATGAAGCCAGTCCTGACAA

KN413382G2, UTRN gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCATTAAGTCCAGATCTGGT

KN413382D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_007124
Synonyms DMDL; DRP; DRP1
Summary This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]


Other Versions

Other products for "UTRN"
Frequently bought together (1)
UTRN (Myc-DDK-tagged)-Human utrophin (UTRN)
    • 10 ug

USD 4,120.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools