Tmem173 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN317757RB

Reviews ()
Write a review

Tmem173 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
4 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA RFP-BSD
Symbol 2610307O08Rik
Locus ID 72512
Kit Components

KN317757G1, 2610307O08Rik gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGCGGTGACCTCTGGGCCGT

KN317757G2, 2610307O08Rik gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGCCAGCCTGATGATCCTT

KN317757RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet

AAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGGGTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGTTGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGAGGCTACAGTCAGTGGAGAGGACTTTCACAGGCTGTCGCCGTGCTCATTTGATAACTGCCCGTTATTCATGCGACACGGGGGGGGGTGCTTTGGCAGGAAACACCAAAAAGAATAAAGAGCTGGCCAGATGGCTAGCTTCCTCCCAGAGCACTGAAAACTGTGCTCTGGCAAGGGCCAGGGCTGTGGTTTTACTGAGGAAGCGAGCTGAGTTGCAGTTGTTTTTAACATTTCGTTTTCAGTCTCCCCATTCAGAAGCCACTTGCTAGTAGCTACTGAAAGGCTCTTCATTGTCTCTTCTGCTCCAGGAACACCGGTCTAGGAAGCAGAAGGTAGGATTAGAAATGGGGCAGTATTCTCCTGGTACTTCGTGGTGGGAGAAACCCTGGGCTGGCAGAACACTCTAAGGTCTAGGTCTTGGATCAGTTTCTTCCTTCTTTCTCACACCAGTGAGCTCAGTGGGGCTCACATGTACACGCTCTGTTTACTATGAACCTCTCCTAGACAGGTGCTGTAGGATGCTATGTGCCCAGGGCGTCTCCTTGAGGTGTATCCAAGAGTAGCCCATGGGACTAGCTGGGCTGGGAGACCCAAGGAGATGGATGACTAGTCAGGACCTTAGGCCCTGAAGGACAGGAGAACCCCAGAAGCATAGCTGTGGATTTCTTGATGTCTACAGCGCACGAACTTGGACTACTGTTGAAAAACCTCTGCTGTCTGGCTGAAGAGCTGTGCCATGTCCAGTCCAGGTAACCCTCTGTGGTCTCCACGATGACTTGATACCCAGCAAGTATCACACCCTTGACTCCTAACCTTGGCCTTCCCTGAACATCATCAGCTGAGTTGGGCTGGGATCTGAGGCTAGGCTGTCCCCTGCAGGTACCAGGGCAGCTACTGGAAGGCTGTGCGCGCCTGCCTGGGATGCCCCATCCACTGTATGGCTATGATTCTACTATCGTCTTATTTCTATTTCCTCCAAAACACTGCTGACATATACCTCAGTTGGATGTTTGGCCTTCTGGTCCTCTATAAGTCCCTAAGCATGCTCCTGGGCCTTCAGGTATGAAGCAGAAGAGGTGGGTGGTGTGGGAAGAGGGGACTATGGCTAGTGCTGGTGTGCCTGAGCTCAGTGCTGAGACTCAGACTAATTTAAAGGTTGGAGACCTGGGTGTGGAGCTATGAAGGCTTGGGATGATGGGTTTAATAGCAGTGCTGAGAGCAAGCTGGCAGCAGGTTGGGAAAGTTTTCTGCAAGAGAAGGGCTTTGGACATCCCCCTTGTCACTCTCGCCGGTTGGACTTTAGATCAGAAGGGATCTTGCTGCCGCCCGAAAGAGGAAGGGCTGGAAGAGGAAGGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGAACCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001289591, NM_001289592, NM_028261
Synonyms 2610307O08Rik; ERIS; Mita; MPYS; STING

Documents

Other Versions

Other products for "2610307O08Rik"
Frequently bought together (1)
Tmem173 (myc-DDK-tagged) - Mouse transmembrane protein 173 (Tmem173), transcript variant 2
    • 10 ug

USD 450.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools