Cd274 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN302893RB

Reviews ()
Write a review

Cd274 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA RFP-BSD
Symbol Cd274
Locus ID 60533
Kit Components

KN302893G1, Cd274 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCCTGCTGTCACTTGCTACG

KN302893G2, Cd274 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGAACCCACTGAAAAGATT

KN302893RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet

AAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGGGTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGTTGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGAGGCTACAGTCAGTGGAGAGGACTTTCACAGGCTGTCGCCGTGCTCATTTGATAACTGCCCGTTATTCATGCGACACACCGGGCCAGATGGAAGTCTCCTTCCTTCCCATAGCTGTTACCACTGTACTGTCTTTACTGGGGAAAAGATTTATCATGTGGAATAGGTGCGAGGCAGAGGTGAGATTTTAATGGGGAGGAAGCATTGAAAAGTGAAAGTGAAAATTGGATGCTCTTTGCTTTGAAGCTTTGCCTAAAGCAGGTTTTAGCTTTCAAATACGTTTCAATGTTGAAAGAACGCATGATACATATGGAGGGGGGCCTGGGGGGGGTCCTTGGCTGAGTTTGAATGTACATTAACAATCTGGGGGGCTAATAACTCAATGTAAAGCTGCTGATCCCATCATACTGACTTCTTTCCACTTGGTTCTACATGGCTTTGAGTTACAAAATGAAAGCATTGAATTTTGAACTGTTCAGCTGTGTTTCCACACTTGCAAATCGGTTGTTGGCCAGCCCTCAGAATTGCTTCAGTTACAGCTGGCTCGTCTGCTCTTTCCAGACTGGCTTTTAGGGCTTATGTATATATGAGAAGGACACATTTACTAGTGTCTCCTTGCTCTGCTATTGAAATTAAGCAGACCTCTCTGTGTTTCCCGTTACTAGATAGTTCCCAAAACCAATATTTTAGCTATGAATTAAAAATGGAAGTAATTTGTGGGGTGTGTATGTGTGTGTATATGTGTGTGTAGAGGGGGGTCTGTGTGTATGTGCAGTTGCTAGGCACACATAAAGCGTTCATAGGACAACCTAGAGCTTAGTCCTCACCTTCTACCTTGTTTGAGACAAGGTCTCTTATTTGTTGTACATTGCTGAGTCCTGTAGTTCGGCTAGCTCAGAACCTCCTGGGGGCTCTCCTGTCTCCACCTCCCAGTCCACTGAGATTGTAGGCACATGCTACTGCACCTGGCTTCTACCTGGTCTCTGGGGATTTGAACTTGGGTCCATGGGCTACACAGCAAGTCGTTTACTTACTGGGCAATCACTCCATCCCCTAAGATAATTATAAGGAATATACCTTGCTTATCCAAACACATTCTCATTCTCCTTTGCCATAAATAAGTTACTTGGCAAATATATTGTATGTATTTTTAATAAATAAATAAAATCTTAAAAATAAATAAAATTATTTGTGAAGACAAAAAAAATAAGTTACTTGGAAAGGATGAAGGAAAATACTGGAGCTTTGGGTGTGGTTTAGTAGTAGAACACTTGGCTGATCACTCTCGCCGGTTGGACTTTAGATCAGAAGGGATCTTGCTGCCGCCCGAAAGAGGAAGGGCTGGAAGAGGAAGGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGAACCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_021893
Synonyms A530045L16Rik; B7h1; Pdcd1l1; Pdcd1lg1; Pdl1
Summary The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]

Documents

Other Versions

Other products for "Cd274"
Frequently bought together (2)
Rat Anti-Mouse PD-L1 / CD274 Purified (100 ug)
    • 100 ug

USD 195.00


PD-L1 / CD274 (Myc-DDK-tagged) - Mouse PD-L1 / CD274 antigen (PD-L1 / CD274)
    • 10 ug

USD 420.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools