Atp6ap2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN301806

Reviews ()
Write a review

Atp6ap2 - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Atp6ap2
Locus ID 70495
Kit Components

KN301806G1, Atp6ap2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TCTGGTGGCGGGTGAGTAGC

KN301806G2, Atp6ap2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCGGGAAGCTAGGGGGCGCG

KN301806-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_027439
Synonyms (P)RR; 5730403E06Rik; APT6M8-9; Atp6ip2; ATP6M8-9; M8-9; PRR


Other Versions

Other products for "Atp6ap2"
Frequently bought together (1)
Atp6ap2 (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal accessory protein 2 (Atp6ap2)
    • 10 ug

USD 300.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools