Interferon beta (IFNB1) Human Gene Knockout Kit (CRISPR)

CAT#: KN218565

IFNB1 - human gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

  See Other Versions

USD 1,657.00

4 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


Rabbit Polyclonal IFN-beta Antibody
    • 100 ug

USD 570.00


IFNB1 (Myc-DDK-tagged)-Human interferon, beta 1, fibroblast (IFNB1)
    • 10 ug

USD 450.00

Other products for "Interferon beta"

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Interferon beta
Locus ID 3456
Components

KN218565G1, Interferon beta gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AATTTGGAGGAGACACTTGT

KN218565G2, Interferon beta gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCCAAGCAAGTTGTAGCTCA

KN218565D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002176
UniProt ID P01574
Synonyms IFB; IFF; IFNB
Summary This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.