KAT3A / CBP (CREBBP) Human Gene Knockout Kit (CRISPR)

CAT#: KN216439

Reviews ()
Write a review

CREBBP - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Locus ID 1387
Kit Components

KN216439G1, CREBBP gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTGTCATTCGCCGAGAAAC

KN216439G2, CREBBP gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACTCAGCTCGCCCGGTTTCT

KN216439-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001079846, NM_004380
Synonyms CBP; KAT3A; RSTS
Summary This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]


Other products for "CREBBP"
Frequently bought together (2)
Rabbit polyclonal anti-CREB-BP antibody
    • 100 ul

USD 345.00

CREBBP (Myc-DDK-tagged)-Human CREB binding protein (CREBBP), transcript variant 1
    • 10 ug

USD 2,930.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones