12 Lipoxygenase (ALOX12) Human Gene Knockout Kit (CRISPR)

CAT#: KN210211

Reviews ()
Write a review

ALOX12 - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol ALOX12
Locus ID 239
Kit Components

KN210211G1, ALOX12 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTGCACGCGGTTGTACGACC

KN210211G2, ALOX12 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TTTGGCTGGTCGGGACGCGC

KN210211-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000697
Synonyms 12-LOX; 12S-LOX; LOG12
Summary This gene encodes a member of the lipoxygenase family of proteins. The encoded enzyme acts on different polyunsaturated fatty acid substrates to generate bioactive lipid mediators including eicosanoids and lipoxins. The encoded enzyme and its reaction products have been shown to regulate platelet function. Elevated expression of this gene has been observed in pancreatic islets derived from human diabetes patients. Allelic variants in this gene may be associated with susceptibility to toxoplasmosis. Multiple pseudogenes of this gene have been identified in the human genome. [provided by RefSeq, Aug 2017]


Other products for "ALOX12"
Frequently bought together (2)
ALOX12 mouse monoclonal antibody, clone OTI1C3 (formerly 1C3)
    • 100 ul

USD 379.00

ALOX12 (Myc-DDK-tagged)-Human arachidonate 12-lipoxygenase (ALOX12)
    • 10 ug

USD 420.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones