CD146 (MCAM) Human Gene Knockout Kit (CRISPR)

CAT#: KN208937

MCAM - human gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

  See Other Versions

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


MCAM mouse monoclonal antibody, clone OTI5C4 (formerly 5C4)
    • 100 ul

USD 447.00


MCAM (Myc-DDK-tagged)-Human melanoma cell adhesion molecule (MCAM)
    • 10 ug

USD 902.00

Other products for "CD146"

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol CD146
Locus ID 4162
Components

KN208937G1, CD146 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGGTGAGTTCGCTCGCAGGG

KN208937G2, CD146 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCACCGCAGACCCCTAGCCG

KN208937D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

Homologous arm and GFP-puro sequences:

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

TCTGTGGGAC TGGCGCAGGG TTCTTCTCCC AAAGCTGCCA GCACTGAGGC TGAGGCAGTG TCAGGCCGGC GGCAGCGGCA GTGGTGCAAT CGTTCTGGGA AGCGATAGAG GCCGGCCTGA ATTCTCTGTG GCAAGGGAGG GGAGCCCAAG TGGGAGGCCC CTTGGGGACA CCGAGGACCA GGTCCGCTAC TGCTCCTCCC CCAGGAGGTC CCCTAGGGGC TACATTGGCT GGCAGGGGCT GAGCAGCGGT GAGCCTGGCT GGCTTCGACC CGGGGCGACT CCGGGCATCC GGGACAGCTT CTCCTCGCTG CCACCTCGGC CAGTCAGACC CCGAGACACC TGTCACTACC CCCTCAGCCT TCCCAAGCCA GGAGCCTGGG AGTCCGGCTC TGGCCTACCT CCGGCAGCGC TCCTAGGCGC AGCTCCCGGG CTGGCGGCGC CGGGGCCCGC CCCCTAGGGC TGCGGCGCGC GGGGCGGGGG CTGGGGGCTG CGCGGGGCGG GGCGGGCCCG GGCGCTCCGG GCCCCCTCCC CCGCCCCCCT GACGTCAGCC CCCGGCAGCC TCGAGCTGCT CACTTGGCTC TCGCCCTCCG GCCGGGAAGC GCGCGGCGGG GTCGGGGCGT TGCGTCTGGG AGGACGAGCC TCCTCCCTGG GTCCCCGATC CCCGGGCGCC TTGCGCGCGA GCAACTCTTC TTTGCAGCCA GTTTGCAGCC GGGATTCTAG AGTATCCCGG GAGCAGCACT CGGAAGGCGG GGAGGAGGCT GCTTCTGGGA ACGAGAAGGG GTGGAGCTCA GCCTTTCGGG GTGCTGGGGG GTGGGTGGTC CCTGAGGTGC TCACTCTGGG GGCCCGCAAT TGAAGCCGGG CAGGAGGCGC AGCTGGGGCG CATCCTCAAA GCCTGAATTC CGCGCCCGCC TGTTGCTGGA AAAGGCAGCT TCCTTCGCTG GAGGGGGTGC GCCGACCCAC CCCTTCCCCC TTCTGCCTGG GCATCACGCC AGGCTGGAGG TGAGCGAGAG CGGGAGGTTC GGCGGCTCCC GCCCGAGCTG GGCGTTGGCA GGGGTTGCGG GGCGGTGTGG GTCGCCTCGC GCCTCCCCGA GTGATGGGAT CATAGGGGAC AGAGATGAGG GATGGAGGAT TCCCATACTG GAAGCGCCCG CTGGCTTATT TTGGGGACCA CATTCAGGTG GGAAGTGCGC CCGGGCACCT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_006500
UniProt ID P43121
Synonyms CD146; MUC18
Summary Plays a role in cell adhesion, and in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. Its expression may allow melanoma cells to interact with cellular elements of the vascular system, thereby enhancing hematogeneous tumor spread. Could be an adhesion molecule active in neural crest cells during embryonic development. Acts as surface receptor that triggers tyrosine phosphorylation of FYN and PTK2/FAK1, and a transient increase in the intracellular calcium concentration.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.