Superoxide Dismutase 1 (SOD1) Human Gene Knockout Kit (CRISPR)

CAT#: KN200725

Reviews ()
Write a review

SOD1 - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Superoxide Dismutase 1
Locus ID 6647
Kit Components

KN200725G1, Superoxide Dismutase 1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAGGCCGTGTGCGTGCTGAA

KN200725G2, Superoxide Dismutase 1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CAATTTCGAGCAGAAGGCAA

KN200725-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000454
Synonyms ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD
Summary The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2008]


Other Versions

Other products for "Superoxide Dismutase 1"
Frequently bought together (2)
SOD1 (Superoxide Dismutase 1) mouse monoclonal antibody, clone OTI8B10 (formerly 8B10)
    • 100 ul

USD 379.00

SOD1 (Myc-DDK-tagged)-Human superoxide dismutase 1, soluble (SOD1)
    • 10 ug

USD 98.00 USD 390.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools