Sequencing Primer, LR50-R

CAT#: GE100122

Reviews ()
Write a review

Reverse primer to sequence targets cloned in expression vectors.



USD 66.00


Availability*
In Stock

Size
    • 1 nmol

Product images

Specifications

Product Data
Forward Sequence 5' CTTATCGATAATCAACCTCTG 3'
Applicable Vectors PS100064
Components 1 vial of lyophilized squencing primer (1 nmol, sufficient for 100 sequencing reactions)
Quality Control The primer has been tested to generate satisfactory squencing data on ABI 3730.
Storage Store at -20°C.
Stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C

Documents

Frequently bought together (4)
CAS9 mouse monoclonal antibody,clone OTI5E5
    • 100 ul

USD 417.00


Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools