Mouse Krt5 activation kit by CRISPRa
CAT#: GA212304
Krt5 CRISPRa kit - CRISPR gene activation of mouse keratin 5
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | Krt5 |
Locus ID | 110308 |
Kit Components | GA212304G1, Krt5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCAGGACACCAGCTCTGTA GA212304G2, Krt5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACCACTGTGCAGGTGTGC GA212304G3, Krt5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTGGGCTGGGCATGCCTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_027011 |
UniProt ID | Q922U2 |
Synonyms | 3300001P10Rik; AW146334; CK5; K5; Krt2-5; Tfip8 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN509006 | Krt5 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review