Mouse Stat6 activation kit by CRISPRa

CAT#: GA204128

Stat6 CRISPRa kit - CRISPR gene activation of mouse signal transducer and activator of transcription 6

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: Stat6
• Locus ID: 20852
• Kit Components:

  GA204128G1, Stat6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGAGAAGAGAAAGTGGGC

  GA204128G2, Stat6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGAGGAAGAGGAAGAAAG

  GA204128G3, Stat6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCCCACCGGGTACATAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_009284
• UniProt ID: P52633
• Summary: Carries out a dual function: signal transduction and activation of transcription. Involved in IL4/interleukin-4- and IL3/interleukin-3-mediated signaling.[UniProtKB/Swiss-Prot Function]