Human TA1 (TAAR1) activation kit by CRISPRa
CAT#: GA115239
TAAR1 CRISPRa kit - CRISPR gene activation of human trace amine associated receptor 1
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | TAAR1 |
Locus ID | 134864 |
Kit Components | GA115239G1, TA1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTAACCTGATTATGGATTT GA115239G2, TA1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGATAAATCAACACACAAA GA115239G3, TA1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGATAAATCAACACACAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_138327 |
UniProt ID | Q96RJ0 |
Synonyms | TA1; TAR1; TRAR1 |
Summary | The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN411034 | TAAR1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review