Human PD1 (PDCD1) activation kit by CRISPRa

CAT#: GA103431

PDCD1 CRISPRa kit - CRISPR gene activation of human programmed cell death 1

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: PDCD1
• Locus ID: 5133
• Kit Components:

  GA103431G1, PD1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGGTCAGGTTGAAGGGA

  GA103431G2, PD1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGAGTGACAGAGGCAGTGC

  GA103431G3, PD1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGAGGAGGGGGTAGGACT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_005018
• UniProt ID: Q15116
• Synonyms: CD279; hPD-1; hPD-l; hSLE1; PD-1; PD1; SLEB2
• Summary: Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. [provided by RefSeq, Aug 2020]