Human CD229 (LY9) activation kit by CRISPRa
CAT#: GA102757
LY9 CRISPRa kit - CRISPR gene activation of human lymphocyte antigen 9
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | LY9 |
Locus ID | 4063 |
Kit Components | GA102757G1, CD229 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGTGTGTGTCTCAGAGGGA GA102757G2, CD229 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTACCTGCCTGCGCAGAT GA102757G3, CD229 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGCAGATGGGAGGAGTCTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001033667, NM_001261456, NM_001261457, NM_002348 |
UniProt ID | Q9HBG7 |
Synonyms | CD229; hly9; mLY9; SLAMF3 |
Summary | LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN418201 | LY9 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review