Human CACNA1A activation kit by CRISPRa
CAT#: GA100538
CACNA1A CRISPRa kit - CRISPR gene activation of human calcium voltage-gated channel subunit alpha1 A
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CACNA1A |
Locus ID | 773 |
Kit Components | GA100538G1, CACNA1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTCCGGAGTGGGTGGACTG GA100538G2, CACNA1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTCCTCCGAGGTCCGGGTC GA100538G3, CACNA1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGAAACCCAGGTCTGGGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_000068, NM_001127221, NM_001127222, NM_001174080, NM_023035 |
UniProt ID | O00555 |
Synonyms | APCA; BI; CACNL1A4; CAV2.1; EA2; FHM; HPCA; MHP; MHP1; SCA6 |
Summary | Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN414314 | CACNA1A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review