CTNNA2 (NM_001282597) Human Untagged Clone

CAT#: SC337712

Reviews ()
Write a review

CTNNA2 (untagged) - Human catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 3

  View "NM_001282597" in other vectors (1)

USD 970.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CTNNA2 (NM_001282597) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol CTNNA2
Synonyms CAP-R; CAPR; CDCBM9; CT114; CTNR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282597, the custom clone sequence may differ by one or more nucleotides


ATGACTTCGGCAACTTCACCTATCATTCTGAAATGGGACCCCAAAAGTTTGGAAATCCGGACGCTAACAG
TGGAAAGGCTGTTGGAGCCACTTGTTACACAGGTGACTACACTTGTCAACACAAGCAACAAAGGCCCATC
TGGTAAAAAGAAAGGGAGGTCAAAGAAAGCCCATGTACTAGCTGCCTCTGTAGAGCAAGCCACTCAGAAT
TTCCTGGAAAAGGGTGAACAGATCGCTAAGGAGAGTCAAGATCTCAAAGAAGAGTTGGTGGCTGCTGTAG
AGGATGTGCGCAAACAAGGTGAGACGATGCGGATCGCCTCCTCCGAGTTTGCAGATGACCCTTGCTCGTC
GGTAAAGCGCGGCACCATGGTACGGGCGGCAAGGGCTTTGCTCTCCGCGGTGACACGCTTACTCATCCTG
GCGGACATGGCAGATGTCATGAGACTTTTATCCCATCTGAAAATTGTGGAAGAGGCCCTGGAAGCTGTCA
AAAATGCTACAAATGAGCAAGACCTTGCAAACCGTTTTAAAGAGTTTGGGAAAGAGATGGTGAAACTTAA
CTATGTAGCAGCAAGAAGACAACAGGAGCTGAAGGATCCTCACTGTCGGGATGAGATGGCAGCCGCCCGA
GGGGCTCTGAAGAAGAATGCCACAATGCTGTACACGGCCTCTCAAGCATTTCTCCGCCACCCAGATGTCG
CCGCTACGAGAGCCAACCGAGATTATGTGTTCAAACAAGTCCAGGAGGCCATCGCCGGCATCTCCAATGC
TGCTCAAGCTACCTCGCCCACTGACGAAGCCAAGGGCCACACGGGCATCGGCGAGCTGGCTGCGGCTCTT
AATGAGTTTGACAATAAGATTATCCTGGACCCCATGACGTTCAGCGAGGCCAGGTTCCGGCCGTCCCTGG
AGGAGAGGCTGGAGAGCATCATCAGCGGCGCAGCGCTGATGGCCGACTCCTCCTGCACGCGAGACGACCG
GCGCGAGAGGATCGTGGCGGAGTGCAACGCCGTGCGGCAGGCGCTCCAGGACCTGCTCAGCGAGTACATG
AATAATACTGGAAGGAAAGAAAAAGGAGATCCTCTCAACATTGCGATTGATAAGATGACTAAGAAAACAA
GAGATCTAAGGAGACAGCTTCGGAAAGCAGTGATGGATCACATATCTGACTCTTTCCTGGAAACCAATGT
TCCTTTGCTAGTTCTCATTGAGGCTGCAAAGAGCGGAAATGAAAAGGAAGTGAAAGAATATGCCCAAGTT
TTCCGTGAGCATGCCAACAAACTGGTAGAGGTTGCCAATTTGGCCTGTTCCATCTCCAACAATGAAGAAG
GGGTGAAATTAGTTCGGATGGCAGCCACCCAGATTGACAGCCTGTGTCCCCAGGTCATCAATGCCGCTCT
GACACTGGCTGCCCGGCCACAGAGCAAAGTTGCTCAGGATAACATGGACGTCTTCAAAGACCAGTGGGAG
AAGCAGGTCCGAGTGTTGACAGAGGCCGTGGATGACATCACCTCAGTGGATGACTTCCTCTCTGTCTCAG
AAAATCACATCTTGGAGGATGTGAACAAGTGTGTGATAGCCCTCCAAGAGGGCGATGTGGACACTCTGGA
CCGGACTGCAGGGGCCATCAGGGGCCGGGCAGCTCGAGTCATACACATCATCAATGCTGAGATGGAGAAC
TATGAAGCTGGGGTTTATACTGAGAAGGTGTTGGAAGCTACAAAATTGCTTTCTGAAACAGTGATGCCAC
GCTTCGCTGAACAAGTAGAGGTTGCCATTGAAGCCCTGAGTGCCAACGTTCCTCAACCGTTTGAGGAGAA
TGAGTTCATCGATGCCTCTCGCCTGGTGTATGATGGCGTTCGGGACATCAGAAAGGCTGTGCTGATGATC
AGGACCCCAGAAGAACTAGAGGATGATTCTGACTTTGAGCAGGAAGATTATGATGTGCGTAGCAGGACAA
GTGTTCAGACTGAGGATGACCAGCTCATTGCAGGGCAGAGCGCACGGGCCATCATGGCGCAACTACCGCA
GGAGGAGAAGGCAAAAATAGCTGAGCAGGTGGAGATATTCCATCAAGAGAAAAGCAAGCTGGATGCAGAA
GTGGCCAAATGGGACGACAGCGGCAATGATATCATTGTACTGGCCAAGCAGATGTGTATGATCATGATGG
AAATGACAGACTTCACAAGAGGCAAAGGCCCATTGAAAAATACATCTGATGTCATTAATGCTGCCAAGAA
AATTGCCGAAGCAGGTTCTCGAATGGACAAATTAGCTCGTGCTGTGGCTGATCAGTGTCCTGATTCAGCA
TGTAAGCAGGATTTATTAGCCTACCTTCAACGAATTGCCTTGTATTGCCATCAGCTTAATATCTGCAGCA
AGGTGAAGGCAGAAGTGCAGAATCTGGGAGGAGAGCTCATTGTGTCAGGGACAGGAGTTCAGAGCACTTT
CACTACCTTTTATGAGGTAGATTGTGATGTCATAGATGGGGGCAGGGCTAGTCAACTTTCTACCCACCTC
CCAACCTGTGCTGAGGGAGCTCCGATCGGGAGTGGAAGCAGTGATTCCTCCATGCTGGACAGTGCCACAT
CGCTTATCCAGGCAGCTAAAAACCTGATGAATGCTGTTGTCCTCACGGTGAAAGCATCCTATGTGGCCTC
AACCAAATACCAGAAGGTCTATGGGACAGCAGCTGTCAACTCACCTGTTGTGTCTTGGAAGATGAAGGCT
CCAGAGAAGAAGCCCCTTGTGAAGAGAGAAAAGCCTGAAGAATTCCAGACACGAGTTCGACGAGGTTCTC
AGAAGAAACACATTTCGCCTGTACAGGCTTTAAGTGAATTCAAAGCAATGGATTCCTTCTAG


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001282597
ORF Size 2862 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001282597.2, NP_001269526.1
RefSeq Size 4149
RefSeq ORF 2862
Locus ID 1496
Cytogenetics 2p12
Protein Families Druggable Genome
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Endometrial cancer, Leukocyte transendothelial migration, Pathways in cancer, Tight junction

Other Versions

Other products for "CTNNA2"
Frequently bought together (2)
Rabbit Polyclonal Anti-CTNNA2 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones