Activin Receptor Type IIA (ACVR2A) (NM_001278579) Human Untagged Clone

CAT#: SC336547

Reviews ()
Write a review

ACVR2A (untagged) - Human activin A receptor, type IIA (ACVR2A), transcript variant 1


  View "NM_001278579" in other vectors (1)

USD 520.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Activin Receptor Type IIA (ACVR2A) (NM_001278579) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ACVR2A
Synonyms ACTRII; ACVR2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278579, the custom clone sequence may differ by one or more nucleotides


ATGGGAGCTGCTGCAAAGTTGGCGTTTGCCGTCTTTCTTATCTCCTGTTCTTCAGGTGCTATACTTGGTA
GATCAGAAACTCAGGAGTGTCTTTTCTTTAATGCTAATTGGGAAAAAGACAGAACCAATCAAACTGGTGT
TGAACCGTGTTATGGTGACAAAGATAAACGGCGGCATTGTTTTGCTACCTGGAAGAATATTTCTGGTTCC
ATTGAAATAGTGAAACAAGGTTGTTGGCTGGATGATATCAACTGCTATGACAGGACTGATTGTGTAGAAA
AAAAAGACAGCCCTGAAGTATATTTTTGTTGCTGTGAGGGCAATATGTGTAATGAAAAGTTTTCTTATTT
TCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCAGTTACACCTAAGCCACCCTATTACAACATCCTG
CTCTATTCCTTGGTGCCACTTATGTTAATTGCGGGGATTGTCATTTGTGCATTTTGGGTGTACAGGCATC
ACAAGATGGCCTACCCTCCTGTACTTGTTCCAACTCAAGACCCAGGACCACCCCCACCTTCTCCATTACT
AGGTTTGAAACCACTGCAGTTATTAGAAGTGAAAGCAAGGGGAAGATTTGGTTGTGTCTGGAAAGCCCAG
TTGCTTAACGAATATGTGGCTGTCAAAATATTTCCAATACAGGACAAACAGTCATGGCAAAATGAATACG
AAGTCTACAGTTTGCCTGGAATGAAGCATGAGAACATATTACAGTTCATTGGTGCAGAAAAACGAGGCAC
CAGTGTTGATGTGGATCTTTGGCTGATCACAGCATTTCATGAAAAGGGTTCACTATCAGACTTTCTTAAG
GCTAATGTGGTCTCTTGGAATGAACTGTGTCATATTGCAGAAACCATGGCTAGAGGATTGGCATATTTAC
ATGAGGATATACCTGGCCTAAAAGATGGCCACAAACCTGCCATATCTCACAGGGACATCAAAAGTAAAAA
TGTGCTGTTGAAAAACAACCTGACAGCTTGCATTGCTGACTTTGGGTTGGCCTTAAAATTTGAGGCTGGC
AAGTCTGCAGGCGATACCCATGGACAGGTTGGTACCCGGAGGTACATGGCTCCAGAGGTATTAGAGGGTG
CTATAAACTTCCAAAGGGATGCATTTTTGAGGATAGATATGTATGCCATGGGATTAGTCCTATGGGAACT
GGCTTCTCGCTGTACTGCTGCAGATGGACCTGTAGATGAATACATGTTGCCATTTGAGGAGGAAATTGGC
CAGCATCCATCTCTTGAAGACATGCAGGAAGTTGTTGTGCATAAAAAAAAGAGGCCTGTTTTAAGAGATT
ATTGGCAGAAACATGCTGGAATGGCAATGCTCTGTGAAACCATTGAAGAATGTTGGGATCACGACGCAGA
AGCCAGGTTATCAGCTGGATGTGTAGGTGAAAGAATTACCCAGATGCAGAGACTAACAAATATTATTACC
ACAGAGGACATTGTAACAGTGGTCACAATGGTGACAAATGTTGACTTTCCTCCCAAAGAATCTAGTCTAT
GA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001278579
ORF Size 1542 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001278579.1, NP_001265508.1
RefSeq Size 5374
RefSeq ORF 1542
Locus ID 92
Cytogenetics 2q22.3-q23.1
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
Gene Summary This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same isoform (1).

Other Versions

Other products for "ACVR2A"
Frequently bought together (2)
ACVR2A mouse monoclonal antibody,clone OTI1F2
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones