IL20 Receptor alpha (IL20RA) (NM_001278722) Human Untagged Clone

CAT#: SC336493

Reviews ()
Write a review

IL20RA (untagged) - Human interleukin 20 receptor, alpha (IL20RA), transcript variant 2



  "NM_001278722" in other vectors (1)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 500.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name IL20 Receptor alpha (IL20RA) (NM_001278722) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol IL20RA
Synonyms CRF2-8; IL-20R-alpha; IL-20R1; IL-20RA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278722, the custom clone sequence may differ by one or more nucleotides


ATGAAGAATGTCCTACAATGGACTCCACCAGAGGGTCTTCAAGGAGTTAAAGTTACTTACACTGTGCAGT
ATTTCATATATGGGCAAAAGAAATGGCTGAATAAATCAGAATGCAGAAATATCAATAGAACCTACTGTGA
TCTTTCTGCTGAAACTTCTGACTACGAACACCAGTATTATGCCAAAGTTAAGGCCATTTGGGGAACAAAG
TGTTCCAAATGGGCTGAAAGTGGACGGTTCTATCCTTTTTTAGAAACACAAATTGGCCCACCAGAGGTGG
CACTGACTACAGATGAGAAGTCCATTTCTGTTGTCCTGACAGCTCCAGAGAAGTGGAAGAGAAATCCAGA
AGACCTTCCTGTTTCCATGCAACAAATATACTCCAATCTGAAGTATAACGTGTCTGTGTTGAATACTAAA
TCAAACAGAACGTGGTCCCAGTGTGTGACCAACCACACGCTGGTGCTCACCTGGCTGGAGCCGAACACTC
TTTACTGCGTACACGTGGAGTCCTTCGTCCCAGGGCCCCCTCGCCGTGCTCAGCCTTCTGAGAAGCAGTG
TGCCAGGACTTTGAAAGATCAATCATCAGAGTTCAAGGCTAAAATCATCTTCTGGTATGTTTTGCCCATA
TCTATTACCGTGTTTCTTTTTTCTGTGATGGGCTATTCCATCTACCGATATATCCACGTTGGCAAAGAGA
AACACCCAGCAAATTTGATTTTGATTTATGGAAATGAATTTGACAAAAGATTCTTTGTGCCTGCTGAAAA
AATCGTGATTAACTTTATCACCCTCAATATCTCGGATGATTCTAAAATTTCTCATCAGGATATGAGTTTA
CTGGGAAAAAGCAGTGATGTATCCAGCCTTAATGATCCTCAGCCCAGCGGGAACCTGAGGCCCCCTCAGG
AGGAAGAGGAGGTGAAACATTTAGGGTATGCTTCGCATTTGATGGAAATTTTTTGTGACTCTGAAGAAAA
CACGGAAGGTACTTCTCTCACCCAGCAAGAGTCCCTCAGCAGAACAATACCCCCGGATAAAACAGTCATT
GAATATGAATATGATGTCAGAACCACTGACATTTGTGCGGGGCCTGAAGAGCAGGAGCTCAGTTTGCAGG
AGGAGGTGTCCACACAAGGAACATTATTGGAGTCGCAGGCAGCGTTGGCAGTCTTGGGCCCGCAAACGTT
ACAGTACTCATACACCCCTCAGCTCCAAGACTTAGACCCCCTGGCGCAGGAGCACACAGACTCGGAGGAG
GGGCCGGAGGAAGAGCCATCGACGACCCTGGTCGACTGGGATCCCCAAACTGGCAGGCTGTGTATTCCTT
CGCTGTCCAGCTTCGACCAGGATTCAGAGGGCTGCGAGCCTTCTGAGGGGGATGGGCTCGGAGAGGAGGG
TCTTCTATCTAGACTCTATGAGGAGCCGGCTCCAGACAGGCCACCAGGAGAAAATGAAACCTATCTCATG
CAATTCATGGAGGAATGGGGGTTATATGTGCAGATGGAAAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278722
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278722.1, NP_001265651.1
RefSeq Size 3382 bp
RefSeq ORF 1515 bp
Locus ID 53832
Cytogenetics 6q23.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) contains an alternate 5'-most exon, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Other products for "IL20RA"
Frequently bought together (2)
IL20RA mouse monoclonal antibody,clone OTI7H7
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools