WNT8A (NM_001300939) Human Untagged Clone

CAT#: SC335672

WNT8A (untagged) - Human wingless-type MMTV integration site family, member 8A (WNT8A), transcript variant 2


  "NM_001300939" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-WNT8A Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "WNT8A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WNT8A
Synonyms WNT8D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335672 representing NM_001300939.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGTGCTGCATTCAGTGCCTCTGCCTGGTAAGTCCTTTCCCAACCCTCACTCCTTGCCAAGGAGGC
CCCCATTGTCTCATCCCCATTCACCTCTGCCTCACTTTTTCTCTTTTTGGTAGGTCAGTGAACAATTTC
CTGATAACAGGTCCCAAGGCCTATCTGACCTACACGACTAGTGTGGCCTTGGGTGCCCAGAGTGGCATC
GAGGAGTGCAAGTTCCAGTTTGCTTGGGAACGCTGGAACTGCCCTGAAAATGCTCTTCAGCTCTCCACC
CACAACAGGCTGAGAAGTGCTACCAGAGAGACTTCCTTCATACATGCTATCAGCTCTGCTGGAGTCATG
TACATCATCACCAAGAACTGTAGCATGGGTGACTTCGAAAACTGTGGCTGTGATGGGTCAAACAATGGA
AAAACAGGAGGCCATGGCTGGATCTGGGGAGGCTGCAGCGACAATGTGGAATTTGGGGAAAGGATCTCC
AAACTCTTTGTGGACAGTTTGGAGAAGGGGAAGGATGCCAGAGCCCTGATGAATCTTCACAACAACAGG
GCCGGCAGACTGGCAGTGAGAGCCACCATGAAAAGGACATGCAAATGTCATGGCATCTCTGGGAGCTGC
AGCATACAGACATGCTGGCTGCAGCTGGCTGAATTCCGGGAGATGGGAGACTACCTAAAGGCCAAGTAT
GACCAGGCGCTGAAAATTGAAATGGATAAGCGGCAGCTGAGAGCTGGGAACAGCGCCGAGGGCCACTGG
GTGCCCGCTGAGGCCTTCCTTCCTAGCGCAGAGGCGGAACTGATCTTTTTAGAGGAATCACCAGATTAC
TGTACCTGCAATTCCAGCCTGGGCATCTATGGCACAGAGGGTCGTGAGTGCCTACAGAACAGCCACAAC
ACATCCAGGTGGGAGCGACGTAGCTGTGGGCGCCTGTGCACTGAGTGTGGGCTGCAGGTGGAAGAGAGG
AAAACTGAGGTCATAAGCAGCTGTAACTGCAAATTCCAGTGGTGCTGTACGGTCAAGTGTGACCAGTGT
AGGCATGTGGTGAGCAAGTATTACTGCGCACGCTCCCCAGGCAGTGCCCAGTCCCTGGGTAAGGGCAGT
GCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300939
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300939.1
RefSeq Size 1814 bp
RefSeq ORF 1110 bp
Locus ID 7478
UniProt ID Q9H1J5
Cytogenetics 5q31.2
Protein Families Cancer stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
MW 40.9 kDa
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) has an additional segment in the 3' region, which results in an alternate translation stop codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.