KCTD20 (NM_001286579) Human Untagged Clone

CAT#: SC334857

KCTD20 (untagged) - Human potassium channel tetramerization domain containing 20 (KCTD20), transcript variant 2


  "NM_001286579" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
KCTD20 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KCTD20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCTD20
Synonyms C6orf69; dJ108K11.3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286579, the custom clone sequence may differ by one or more nucleotides


ATGAATGTTCACCGTGGCAGTGACAGTGACAGGTTATTGCGGCAGGAGGCCAGCTGCTTAGTGGATGATA
CTTTAGCTGTAGCCCAAGAAAAAGAAGCAAACAGCCTGGCTTCATCTGGTCCTCATAATCTTACTTATCC
TCTAGGTCCCAGGAATGAAGGTGCTTTACTCCATGAACTGTCTAATGACGGTGCTCATAAGCAGTTTGAT
CACTACCTCGAAGAGCTCATCTTGCCCATCATGGTGGGCTGTGCCAAGAAAGGAGAACGAGAGTGCCACA
TTGTTGTGCTGACGGATGAGGATTCTGTGGACTGGGATGAAGACCACCCTCCACCAATGGGGGAGGAATA
TTCCCAAATTCTTTATAGCTCCAAGCTCTACAGATTCTTCAAATATATTGAGAATAGGGATGTTGCAAAA
ACAGTGTTAAAGGAACGGGGCCTAAAAAACATTCGCATTGGAATTGAAGGTTACCCTACCTGTAAAGAAA
AAATTAAGAGAAGGCCTGGCGGCCGGTCTGAAGTCATCTATAATTATGTACAACGCCCCTTCATCCAGAT
GTCATGGGAAAAGGAAGAAGGGAAGAGTCGCCATGTGGATTTCCAGTGTGTTCGAAGCAAATCCCTCACG
AATCTGGTAGCTGCTGGAGATGATGTCTTGGAGGACCAGGAGATATTAATGCATCACCCACCCCAAGTGG
ATGAACTTGACCGGCTAAATGCCCCACTTTCTCAGATGGCTTCTAACGACTTTCAGGATTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286579
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286579.1, NP_001273508.1
RefSeq Size 5145 bp
RefSeq ORF 762 bp
Locus ID 222658
UniProt ID Q7Z5Y7
Cytogenetics 6p21.31
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Promotes the phosphorylation of AKT family members.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks three alternate exons, resulting in the loss of an in-frame segment in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.