C22orf25 (TANGO2) (NM_001283154) Human Untagged Clone
SKU
SC334844
TANGO2 (untagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 6
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | C22orf25 |
Synonyms | C22orf25; MECRCN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001283154, the custom clone sequence may differ by one or more nucleotides
ATGTGCATCATCTTCTTTAAGTTTGATCCTCGCCCTGTTTCCAAAAACGCGTACAGGCTCATCTTGGCAG CCAACAGGGATGAATTCTACAGCCGACCCTCCAAGTTAGCTGACTTCTGGGGGAACAACAACGAGATCCT CAGTGGGCTGGACATGGAGGAAGGCAAGGAAGGAGGCACATGGCTGGGCATCAGCACACGTGGCAAGCTG GCAGCACTCACCAACTACCTGCAGCCGCAGCTGGACTGGCAGGCCCGAGGGCGAGGTGAACTTGTCACCC ACTTTCTGACCACTGACGTGGACAGCTTGTCCTACCTGAAGAAGGTCTCTATGGAGGGCCATCTGTACAA TGGCTTCAACCTCATAGCAGCCGACCTGAGCACAGCAAAGGGAGACGTCATTTGCTACTATGGGAACCGA GGGGAGCCTGATCCTATCGTTTTGACGCCAGGCACCTACGGGCTGAGCAACGCGCTGCTGGAGACTCCCT GGAGGAAGCTGTGCTTTGGGAAGCAGCTCTTCCTGGAGGCTGTGGAACGGAGCCAGGCGCTGCCCAAGGA TGTGCTCATCGCCAGCCTCCTGGATGTGCTCAACAATGAAGAGGCAGCTGCCAGACCCGGCCATCGAGGA CCAGGGTGGGGAGTACGTGCAGCCCATGCTGAGCAAGTACGCGGCTGTGTGCGTGCGCTGCCCTGGCTAC GGCACCAGAACCAACACTATCATCCTGGTAGATGCGGACGGCCACGTGACCTTCACTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001283154 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001283154.2, NP_001270083.1 |
RefSeq Size | 3548 bp |
RefSeq ORF | 759 bp |
Locus ID | 128989 |
UniProt ID | Q6ICL3 |
Cytogenetics | 22q11.21 |
Summary | This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC236950 | TANGO2 (myc-DDK-tagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 6 | 10 ug |
$330.00
|
|
RG236950 | TANGO2 (tGFP-tagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 6 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.