CIB1 (NM_001277764) Human Untagged Clone
SKU
SC334654
CIB1 (untagged) - Human calcium and integrin binding 1 (calmyrin) (CIB1), transcript variant a
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CIB1 |
Synonyms | CIB; CIBP; KIP1; PRKDCIP; SIP2-28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001277764, the custom clone sequence may differ by one or more nucleotides
ATGGGGGGCTCGGGCAGTCGCCTGTCCAAGGAGCTGCTGGCCGAGTACCAGGACTTGACGTTCCTGACGA AGCAGGAGATCCTCCTTTCTGTGTACGTGGTTTTAGCTCCTCACCTGGTTGACAATGAGCAGCAGGCAAG GAGTGGGAATGAACACACAGGGAGACCGATCGCTGAGAACACCGACAGTTCCCCTCTCTCTACCAGAGCC CACAGGCGGTTTTGTGAGCTGCTTCCCCAGGAGCAGCGGAGCGTGGAGTCGTCACTTCGGGCACAAGTGC CCTTCGAGCAGATTCTCAGCCTTCCAGAGCTCAAGGCCAACCCCTTCAAGGAGCGAATCTGCAGGGTCTT CTCCACATCCCCAGCCAAAGACAGCCTTAGCTTTGAGGACTTCCTGGATCTCCTCAGTGTGTTCAGTGAC ACAGCCACGCCAGACATCAAGTCCCATTATGCCTTCCGCATCTTTGACTTTGATGATGACGGAACCTTGA ACAGAGAAGACCTGAGCCGGCTGGTGAACTGCCTCACGGGAGAGGGCGAGGACACACGGCTTAGTGCGTC TGAGATGAAGCAGCTCATCGACAACATCCTGGAGGAGTCTGACATTGACAGGGATGGAACCATCAACCTC TCTGAGTTCCAGCACGTCATCTCCCGTTCTCCAGACTTTGCCAGCTCCTTTAAGATTGTCCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277764 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001277764.1, NP_001264693.1 |
RefSeq Size | 1104 bp |
RefSeq ORF | 696 bp |
Locus ID | 10519 |
UniProt ID | Q99828 |
Cytogenetics | 15q26.1 |
Summary | This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013] Transcript Variant: This variant (a) represents the longest transcript and encodes the longer isoform (a, also known as CIB1a). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.