TSH beta (TSHB) (NM_001277991) Human Untagged Clone

SKU
SC333462
TSHB (untagged) - Human thyroid stimulating hormone, beta (TSHB), transcript variant 2
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TSH beta
Synonyms TSH-B; TSH-BETA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC333462 representing NM_001277991.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCTCTTTTCTGTTCTTTCCCCAGGATATCAATGGCAAACTGTTTCTTCCCAAATATGCTCTGTCC
CAGGATGTTTGCACATATAGAGACTTCATCTACAGGACTGTAGAAATACCAGGATGCCCACTCCATGTT
GCTCCCTATTTTTCCTATCCTGTTGCTTTAAGCTGTAAGTGTGGCAAGTGCAATACTGACTATAGTGAC
TGCATACATGAAGCCATCAAGACAAACTACTGTACCAAACCTCAGAAGTCTTATCTGGTAGGATTTTCT
GTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001277991
Insert Size 282 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001277991.1
RefSeq Size 364 bp
RefSeq ORF 282 bp
Locus ID 7252
UniProt ID P01222
Cytogenetics 1p13.2
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Autoimmune thyroid disease, Neuroactive ligand-receptor interaction
MW 10.6 kDa
Summary The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) initiates translation at an alternate start codon and contains an intronless coding sequence, compared to variant 1. The encoded isoform (2, also known as novel TSH-beta) has a distinct N-terminus and is shorter than isoform 1. This variant is based on experimental data in PMIDs 19364510 and 22752807. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on data in published reports (PMIDs 19364510 and 22752807).
Write Your Own Review
You're reviewing:TSH beta (TSHB) (NM_001277991) Human Untagged Clone
Your Rating
SKU Description Size Price
RC235568 TSHB (myc-DDK-tagged) - Human thyroid stimulating hormone, beta (TSHB), transcript variant 2 10 ug
$165.00
RG235568 TSHB (tGFP-tagged) - Human thyroid stimulating hormone, beta (TSHB), transcript variant 2 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.