SLC38A9 (NM_001258287) Human Untagged Clone

SKU
SC332636
SLC38A9 (untagged) - Homo sapiens solute carrier family 38, member 9 (SLC38A9), transcript variant 3
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC38A9
Synonyms URLC11
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332636 representing NM_001258287.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTATTTGCATTTTAACATGGAGAATCCGGCCTTTCTGTATAGAGCCCACAAACATCGTGAATGTG
AATCATGTCATTCAGAGGGTTAGTGACCATGCCTCTGCCATGAACAAGAGAATTCATTACTACAGCCGG
CTCACCACTCCTGCAGACAAGGCACTGATTGCCCCAGACCATGTAGTTCCAGCTCCAGAAGAGTGCTAT
GTGTATAGTCCATTGGGCTCTGCTTATAAACTTCAAAGTTACACTGAAGGATACGGTAAAAACACCAGT
TTAGTAACCATTTTTATGATTTGGAATACCATGATGGGAACATCTATACTAAGCATTCCTTGGGGCATA
AAACAGGCTGGATTTACTACTGGAATGTGTGTCATCATACTGATGGGCCTTTTAACACTTTATTGCTGC
TACAGAGTAGTGAAATCACGGACTATGATGTTTTCGTTGGATACCACTAGCTGGGAATATCCAGATGTC
TGCAGACATTATTTCGGCTCCTTTGGGCAGTGGTCGAGTCTCCTTTTCTCCTTGGTGTCTCTCATTGGA
GCAATGATAGTTTATTGGGTGCTTATGTCAAATTTTCTTTTTAATACTGGAAAGTTTATTTTTAATTTT
ATTCATCACATTAATGACACAGACACTATACTGAGTACCAATAATAGCAACCCTGTGATTTGTCCAAGT
GCCGGGAGTGGAGGCCATCCTGACAACAGCTCTATGATTTTCTATGCCAATGACACAGGAGCCCAACAG
TTTGAAAAGTGGTGGGATAAGTCCAGGACAGTCCCCTTTTATCTTGTAGGGCTCCTCCTCCCACTGCTC
AATTTCAAGTCTCCTTCATTTTTTTCAAAATTTAATATCCTAGAGATAAGATTTCAGTTTCCACAGCTG
ACTGGAGTGCTTACCCTTGCTTTTTTTATTCATAATTGTATCATCACACTCTTGAAGAACAACAAGAAA
CAAGAAAACAATGTGAGGGACTTGTGCATTGCTTATATGCTGGTGACATTAACTTATCTCTATATTGGA
GTCCTGGTTTTTGCTTCATTTCCTTCACCACCATTATCCAAAGATTGTATTGAGCAGAATTTTTTAGAC
AACTTCCCTAGCAGTGACACCCTGTCCTTCATTGCAAGGATATTCCTGCTGTTCCAGATGATGACTGTA
TACCCACTCTTAGGCTACCTGGCTCGTGTCCAGCTTTTGGGCCATATCTTCGGTGACATTTATCCTAGC
ATTTTCCATGTGCTGATTCTTAATCTAATTATTGTGGGAGCTGGAGTGATCATGGCCTGTTTCTACCCA
AACATAGGAGGGATCATAAGATATTCAGGAGCAGCATGTGGACTGGCCTTTGTATTCATATACCCATCT
CTCATCTATATAATTTCCCTCCACCAAGAAGAGCGTCTGACATGGCCTAAATTAATCTTCCACGTTTTC
ATCATCATTTTGGGCGTGGCTAACCTGATTGTTCAGTTTTTTATGTGA

Restriction Sites SgfI-MluI
ACCN NM_001258287
Insert Size 1497 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001258287.1
RefSeq Size 2689 bp
RefSeq ORF 1497 bp
Locus ID 153129
UniProt ID Q8NBW4
Cytogenetics 5q11.2
Protein Families Transmembrane
MW 56.5 kDa
Summary Lysosomal amino acid transporter involved in the activation of mTORC1 in response to amino acid levels. Probably acts as an amino acid sensor of the Rag GTPases and Ragulator complexes, 2 complexes involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids (PubMed:25561175, PubMed:25567906, PubMed:29053970). Following activation by amino acids, the Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. SLC38A9 mediates transport of amino acids with low capacity and specificity with a slight preference for polar amino acids (PubMed:25561175, PubMed:25567906). Acts as an arginine sensor (PubMed:25567906, PubMed:29053970). Following activation by arginine binding, mediates transport of leucine, tyrosine and phenylalanine with high efficiency, and is required for the efficient utilization of these amino acids after lysosomal protein degradation (PubMed:29053970).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has multiple differences, including translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
Write Your Own Review
You're reviewing:SLC38A9 (NM_001258287) Human Untagged Clone
Your Rating
SKU Description Size Price
RC234293 SLC38A9 (Myc-DDK tagged) - Homo sapiens solute carrier family 38, member 9 (SLC38A9), transcript variant 3 10 ug
$503.00
RG234293 SLC38A9 (tGFP-tagged) - Homo sapiens solute carrier family 38, member 9 (SLC38A9), transcript variant 3 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.