EDA2R (NM_001242310) Human Untagged Clone
CAT#: SC329918
EDA2R (untagged) - Homo sapiens ectodysplasin A2 receptor (EDA2R), transcript variant 3
"NM_001242310" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "EDA2R"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDA2R |
Synonyms | EDA-A2R; EDAA2R; TNFRSF27; XEDAR |
Vector | pCMV6-Entry |
Sequence Data |
>SC329918 representing NM_001242310.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATTGCCAAGAAAATGAGTACTGGGACCAATGGGGACGGTGTGTCACCTGCCAACGGTGTGGTCCT GGACAGGAGCTATCCAAGGATTGTGGTTATGGAGAGGGTGGAGATGCCTACTGCACAGCCTGCCCTCCT CGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGT GTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGA AAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAG GTTCAATGTGCCTTCCAGTTGAGCTTAGTGGAGGCAGATGCACCCACAGTGCCCCCTCAGGAGGCCACA CTTGTTGCACTGGTGAGCAGCCTGCTAGTGGTGTTTACCCTGGCCTTCCTGGGGCTCTTCTTCCTCTAC TGCAAGCAGTTCTTCAACAGACATTGCCAGCGTGAGAAATTGATTATTTTCTCTGATCCAGTACCAGCT AGCCTCAATCTGATACCTGAATTTGCAGGAGGTTTGCTGCAGTTTGAGGCTGATAAAACAGCAAAGGAG GAATCTCTCTTCCCCGTGCCACCCAGCAAGGAGACCAGTGCTGAGTCCCAAGTGAGTGAGAACATCTTT CAGACCCAGCCACTTAACCCTATCCTCGAGGACGACTGCAGCTCGACTAGTGGCTTCCCCACACAGGAG TCCTTTACCATGGCCTCCTGCACCTCAGAGAGCCACTCCCACTGGGTCCACAGCCCCATCGAATGCACA GAGCTGGACCTGCAAAAGTTTTCCAGCTCTGCCTCCTATACTGGAGCTGAGACCTTGGGGGGAAACACA GTCGAAAGCACTGGAGACAGGCTGGAGCTCAATGTGCCCTTTGAAGTTCCCAGCCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242310 |
Insert Size | 957 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242310.1 |
RefSeq Size | 3434 bp |
RefSeq ORF | 957 bp |
Locus ID | 60401 |
UniProt ID | Q9HAV5 |
Cytogenetics | Xq12 |
Protein Families | Druggable Genome, Transcription Factors, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
MW | 35 kDa |
Gene Summary | The protein encoded by this gene is a type III transmembrane protein of the TNFR (tumor necrosis factor receptor) superfamily, and contains cysteine-rich repeats and a single transmembrane domain. This protein binds to the EDA-A2 isoform of ectodysplasin, which plays an important role in maintenance of hair and teeth. Alternatively spliced transcript variants encodes distinct protein isoforms. [provided by RefSeq, Apr 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.