EGF (NM_001178130) Human Untagged Clone

CAT#: SC329305

EGF (untagged)-Human epidermal growth factor (EGF) transcript variant 2

USD 2,225


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EGF (NM_001178130) Human Untagged Clone
Symbol EGF
Synonyms HOMG4; URG
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001178130, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTC
TCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACT
TGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGATTGAC
ACAGAAGGAACCAATTATGAGCAATTGGTGGTGGATGCTGGTGTCTCAGTGATCATGGAT
TTTCATTATAATGAGAAAAGAATCTATTGGGTGGATTTAGAAAGACAACTTTTGCAAAGA
GTTTTTCTGAATGGGTCAAGGCAAGAGAGAGTATGTAATATAGAGAAAAATGTTTCTGGA
ATGGCAATAAATTGGATAAATGAAGAAGTTATTTGGTCAAATCAACAGGAAGGAATCATT
ACAGTAACAGATATGAAAGGAAATAATTCCCACATTCTTTTAAGTGCTTTAAAATATCCT
GCAAATGTAGCAGTTGATCCAGTAGAAAGGTTTATATTTTGGTCTTCAGAGGTGGCTGGA
AGCCTTTATAGAGCAGATCTCGATGGTGTGGGAGTGAAGGCTCTGTTGGAGACATCAGAG
AAAATAACAGCTGTGTCATTGGATGTGCTTGATAAGCGGCTGTTTTGGATTCAGTACAAC
AGAGAAGGAAGCAATTCTCTTATTTGCTCCTGTGATTATGATGGAGGTTCTGTCCACATT
AGTAAACATCCAACACAGCATAATTTGTTTGCAATGTCCCTTTTTGGTGACCGTATCTTC
TATTCAACATGGAAAATGAAGACAATTTGGATAGCCAACAAACACACTGGAAAGGACATG
GTTAGAATTAACCTCCATTCATCATTTGTACCACTTGGTGAACTGAAAGTAGTGCATCCA
CTTGCACAACCCAAGGCAGAAGATGACACTTGGGAGCCTGAGCAGAAACTTTGCAAATTG
AGGAAAGGAAACTGCAGCAGCACTGTGTGTGGGCAAGACCTCCAGTCACACTTGTGCATG
TGTGCAGAGGGATACGCCCTAAGTCGAGACCGGAAGTACTGTGAAGATGTTAATGAATGT
GCTTTTTGGAATCATGGCTGTACTCTTGGGTGTAAAAACACCCCTGGATCCTATTACTGC
ACGTGCCCTGTAGGATTTGTTCTGCTTCCTGATGGGAAACGATGTCATCAACTTGTTTCC
TGTCCACGCAATGTGTCTGAATGCAGCCATGACTGTGTTCTGACATCAGAAGGTCCCTTA
TGTTTCTGTCCTGAAGGCTCAGTGCTTGAGAGAGATGGGAAAACATGTAGCGGTTGTTCC
TCACCCGATAATGGTGGATGTAGCCAGCTCTGCGTTCCTCTTAGCCCAGTATCCTGGGAA
TGTGATTGCTTTCCTGGGTATGACCTACAACTGGATGAAAAAAGCTGTGCAGCTTCAGGA
CCACAACCATTTTTGCTGTTTGCCAATTCTCAAGATATTCGACACATGCATTTTGATGGA
ACAGACTATGGAACTCTGCTCAGCCAGCAGATGGGAATGGTTTATGCCCTAGATCATGAC
CCTGTGGAAAATAAGATATACTTTGCCCATACAGCCCTGAAGTGGATAGAGAGAGCTAAT
ATGGATGGTTCCCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTT
GCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGA
AGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCA
CGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAAT
CCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGAT
CTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGAT
GCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACC
CAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCA
GATTGGGCTATGCCATCAGTAATGAGAGTAAACAAGAGGACTGGCAAAGATAGAGTACGT
CTCCAAGGCAGCATGCTGAAGCCCTCATCACTGGTTGTGGTTCATCCATTGGCAAAACCA
GGAGCAGATCCCTGCTTATATCAAAACGGAGGCTGTGAACATATTTGCAAAAAGAGGCTT
GGAACTGCTTGGTGTTCGTGTCGTGAAGGTTTTATGAAAGCCTCAGATGGGAAAACGTGT
CTGGCTCTGGATGGTCATCAGCTGTTGGCAGGTGGTGAAGTTGATCTAAAGAACCAAGTA
ACACCATTGGACATCTTGTCCAAGACTAGAGTGTCAGAAGATAACATTACAGAATCTCAA
CACATGCTAGTGGCTGAAATCATGGTGTCAGATCAAGATGACTGTGCTCCTGTGGGATGC
AGCATGTATGCTCGGTGTATTTCAGAGGGAGAGGATGCCACATGTCAGTGTTTGAAAGGA
TTTGCTGGGGATGGAAAACTATGTTCTGATATAGATGAATGTGAGATGGGTGTCCCAGTG
TGCCCCCCTGCCTCCTCCAAGTGCATCAACACCGAAGGTGGTTATGTCTGCCGGTGCTCA
GAAGGCTACCAAGGAGATGGGATTCACTGTCTTGACTCTACTCCACCCCCTCACCTCAGG
GAAGATGACCACCACTATTCCGTAAGAAATAGTGACTCTGAATGTCCCCTGTCCCACGAT
GGGTACTGCCTCCATGATGGTGTGTGCATGTATATTGAAGCATTGGACAAGTATGCATGC
AACTGTGTTGTTGGCTACATCGGGGAGCGATGTCAGTACCGAGACCTGAAGTGGTGGGAA
CTGCGCCACGCTGGCCACGGGCAGCAGCAGAAGGTCATCGTGGTGGCTGTCTGCGTGGTG
GTGCTTGTCATGCTGCTCCTCCTGAGCCTGTGGGGGGCCCACTACTACAGGACTCAGAAG
CTGCTATCGAAAAACCCAAAGAATCCTTATGAGGAGTCGAGCAGAGATGTGAGGAGTCGC
AGGCCTGCTGACACTGAGGATGGGATGTCCTCTTGCCCTCAACCTTGGTTTGTGGTTATA
AAAGAACACCAAGACCTCAAGAATGGGGGTCAACCAGTGGCTGGTGAGGATGGCCAGGCA
GCAGATGGGTCAATGCAACCAACTTCATGGAGGCAGGAGCCCCAGTTATGTGGAATGGGC
ACAGAGCAAGGCTGCTGGATTCCAGTATCCAGTGATAAGGGCTCCTGTCCCCAGGTAATG
GAGCGAAGCTTTCATATGCCCTCCTATGGGACACAGACCCTTGAAGGGGGTGTCGAGAAG
CCCCATTCTCTCCTATCAGCTAACCCATTATGGCAACAAAGGGCCCTGGACCCACCACAC
CAAATGGAGCTGACTCAGTGA
Tag Tag Free
ACCN NM_001178130
ORF Size 3501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001178130.1, NP_001171601
RefSeq Size 5477
RefSeq ORF 3501
Locus ID 1950
Cytogenetics 4q25
Protein Families ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis, Focal adhesion, Gap junction, Regulation of actin cytoskeleton, Pathways in cancer, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Non-small cell lung cancer
Gene Summary This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016].
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.