CD19 (NM_001178098) Human Untagged Clone

CAT#: SC328905

CD19 (untagged)-Human CD19 molecule (CD19) transcript variant 1

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD19 (NM_001178098) Human Untagged Clone
Symbol CD19
Synonyms B4; CVID3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001178098 edited
AGGCCCCTGCCTGCCCCAGCATCCCCTGCGCGAAGCTGGGTGCCCCGGAGAGTCTGACCA
CCATGCCACCTCCTCGCCTCCTCTTCTTCCTCCTCTTCCTCACCCCCATGGAAGTCAGGC
CCGAGGAACCTCTAGTGGTGAAGGTGGAAGAGGGAGATAACGCTGTGCTGCAGTGCCTCA
AGGGGACCTCAGATGGCCCCACTCAGCAGCTGACCTGGTCTCGGGAGTCCCCGCTTAAAC
CCTTCTTAAAACTCAGCCTGGGGCTGCCAGGCCTGGGAATCCACATGAGGCCCCTGGCCA
TCTGGCTTTTCATCTTCAACGTCTCTCAACAGATGGGGGGCTTCTACCTGTGCCAGCCGG
GGCCCCCCTCTGAGAAGGCCTGGCAGCCTGGCTGGACAGTCAATGTGGAGGGCAGCGGGG
AGCTGTTCCGGTGGAATGTTTCGGACCTAGGTGGCCTGGGCTGTGGCCTGAAGAACAGGT
CCTCAGAGGGCCCCAGCTCCCCTTCCGGGAAGCTCATGAGCCCCAAGCTGTATGTGTGGG
CCAAAGACCGCCCTGAGATCTGGGAGGGAGAGCCTCCGTGTCTCCCACCGAGGGACAGCC
TGAACCAGAGCCTCAGCCAGGACCTCACCATGGCCCCTGGCTCCACACTCTGGCTGTCCT
GTGGGGTACCCCCTGACTCTGTGTCCAGGGGCCCCCTCTCCTGGACCCATGTGCACCCCA
AGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGT
GGGTAATGGAGACGGGTCTGTTGTTGCCCCGGGCCACAGCTCAAGACGCTGGAAAGTATT
ATTGTCACCGTGGCAACCTGACCATGTCATTCCACCTGGAGATCACTGCTCGGCCAGTAC
TATGGCACTGGCTGCTGAGGACTGGTGGCTGGAAGGTCTCAGCTGTGACTTTGGCTTATC
TGATCTTCTGCCTGTGTTCCCTTGTGGGCATTCTTCATCTTCAAAGAGCCCTGGTCCTGA
GGAGGAAAAGAAAGCGAATGACTGACCCCACCAGGAGATTCTTCAAAGTGACGCCTCCCC
CAGGAAGCGGGCCCCAGAACCAGTACGGGAACGTGCTGTCTCTCCCCACACCCACCTCAG
GCCTCGGACGCGCCCAGCGTTGGGCCGCAGGCCTGGGGGGCACTGCCCCGTCTTATGGAA
ACCCGAGCAGCGACGTCCAGGCGGATGGAGCCTTGGGGTCCCGGAGCCCGCCGGGAGTGG
GCCCAGAAGAAGAGGAAGGGGAGGGCTATGAGGAACCTGACAGTGAGGAGGACTCCGAGT
TCTATGAGAACGACTCCAACCTTGGGCAGGACCAGCTCTCCCAGGATGGCAGCGGCTACG
AGAACCCTGAGGATGAGCCCCTGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGT
CTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGA
GCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGCAGGGTCCCAGT
CCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCC
AGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATG
GGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCT
CAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGA
AGACCTCGAC
Tag Tag Free
ACCN NM_001178098
ORF Size 1674 bp
Insert Size 1800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001178098.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001178098.1, NP_001171569
RefSeq Size 1968
RefSeq ORF 1674
Locus ID 930
Cytogenetics 16p11.2
Protein Families Transmembrane, Druggable Genome
Protein Pathways Hematopoietic cell lineage, B cell receptor signaling pathway, Primary immunodeficiency
Gene Summary Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.