Claudin 2(CLDN2) (NM_001171092) Human Untagged Clone

CAT#: SC328366

CLDN2 (untagged)-Human claudin 2 (CLDN2) transcript variant 2

  View "NM_001171092" in other vectors (10)

USD 410.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Claudin 2(CLDN2) (NM_001171092) Human Untagged Clone
Symbol CLDN2
Synonyms SP82
Vector pCMV6-Entry
Sequence Data
>NCBI ORF sequence for NM_001171092, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCTCTTGGCCTCCAACTTGTGGGCTACATCCTAGGCCTTCTGGGGCTTTTGGGCACACTGGTTG
CCATGCTGCTCCCCAGCTGGAAAACAAGTTCTTATGTCGGTGCCAGCATTGTGACAGCAGTTGGCTTCTC
CAAGGGCCTCTGGATGGAATGTGCCACACACAGCACAGGCATCACCCAGTGTGACATCTATAGCACCCTT
CTGGGCCTGCCCGCTGACATCCAGGCTGCCCAGGCCATGATGGTGACATCCAGTGCAATCTCCTCCCTGG
CCTGCATTATCTCTGTGGTGGGCATGAGATGCACAGTCTTCTGCCAGGAATCCCGAGCCAAAGACAGAGT
GGCGGTAGCAGGTGGAGTCTTTTTCATCCTTGGAGGCCTCCTGGGATTCATTCCTGTTGCCTGGAATCTT
CATGGGATCCTACGGGACTTCTACTCACCACTGGTGCCTGACAGCATGAAATTTGAGATTGGAGAGGCTC
TTTACTTGGGCATTATTTCTTCCCTGTTCTCCCTGATAGCTGGAATCATCCTCTGCTTTTCCTGCTCATC
CCAGAGAAATCGCTCCAACTACTACGATGCCTACCAAGCCCAACCTCTTGCCACAAGGAGCTCTCCAAGG
CCTGGTCAACCTCCCAAAGTCAAGAGTGAGTTCAATTCCTACAGCCTGACAGGGTATGTGTGA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001171092
ORF Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001171092.1, NP_001164563
RefSeq Size 3163
RefSeq ORF 693
Locus ID 9075
Cytogenetics Xq22.3
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Tight junction, Leukocyte transendothelial migration
Gene Summary This gene product belongs to the claudin protein family whose members have been identified as major integral membrane proteins localized exclusively at tight junctions. Claudins are expressed in an organ-specific manner and regulate tissue-specific physiologic properties of tight junctions. This protein is expressed in the intestine. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene.[provided by RefSeq, Jan 2010].
Transcript Variant: This variant (2) uses an alternate 5' non-coding exon compared to variant 1. Variants 1-3 encode the same protein.

Other Versions

Other products for "CLDN2"
Frequently bought together (2)
Rabbit Polyclonal Anti-CLDN2 Antibody
    • 100 ul

USD 335.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones