C6orf134 (ATAT1) (NM_024909) Human Untagged Clone

CAT#: SC327797

ATAT1 (untagged)-Human chromosome 6 open reading frame 134 (C6orf134) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATAT1
• Synonyms: alpha-TAT; alpha-TAT1; C6orf134; MEC17; Nbla00487; TAT
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_024909, the custom clone sequence may differ by one or more nucleotides
  ATGGAGTTCCCGTTCGATGTGGACGCGCTGTTCCCGGAGCGGATCACGGTGCTGGACCAG
  CACCTGAGGCCCCCAGCCCGCCGACCCGGAACCACAACGCCGGCCCGTGTTGATCTACAG
  CAGCAAATTATGACCATTATAGATGAACTGGGCAAGGCTTCTGCCAAGGCCCAGAATCTT
  TCCGCTCCTATCACTAGTGCATCAAGGATGCAGAGTAACCGCCATGTTGTTTATATTCTC
  AAAGACAGTTCAGCCCGACCGGCTGGAAAAGGAGCCATTATTGGTTTCATCAAAGTTGGA
  TACAAGAAGCTCTTTGTACTGGATGATCGTGAGGCTCATAATGAGGTAGAACCACTTTGC
  ATCCTGGACTTTTACATCCATGAGTCTGTGCAACGCCATGGCCATGGGCGAGAACTCTTC
  CAGTATATGTTGCAGAAGGAGCGAGTGGAACCGCACCAACTGGCAATTGACCGACCCTCA
  CAGAAGCTGCTGAAATTCCTGAATAAGCACTACAATCTGGAGACCACAGTCCCACAGGTG
  AACAACTTTGTGATCTTTGAAGGCTTCTTTGCCCATCAACATCGGCCCCCTGCTCCCTCT
  CTGAGGGCAACTCGACACTCTCGTGCTGCTGCAGTCGATCCCACGCCCGCTGCTCCAGCA
  AGGAAGCTGCCACCCAAGAGAGCAGAGGGAGACATCAAGCCATACTCCTCTAGTGACCGA
  GAATTTCTGAAGGTAGCTGTGGAGCCTCCTTGGCCCCTAAACAGGGCCCCTCGCCGCGCC
  ACACCTCCAGCCCACCCACCCCCCCGCTCCAGCAGCCTGGGAAACTCACCAGAACGAGGT
  CCCCTCCGCCCCTTTGTGCCAGAGCAGGAGCTGCTGCGTTCCTTGCGCCTCTGCCCCCCA
  CACCCTACCGCCCGCCTTCTGTTGGCTGCTGACCCTGGGGGCAGCCCAGCTCAACGTCGT
  CGCACCAGCTCCCTTCCCCGCTCTGAGGAGAGTCGATAC
  
• Restriction Sites: Please inquire
• ACCN: NM_024909
• Insert Size: 2163 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_024909.2, NP_079185.2
• RefSeq Size: 2163 bp
• RefSeq ORF: 1002 bp
• Locus ID: 79969
• UniProt ID: Q5SQI0
• Cytogenetics: 6p21.33
• Gene Summary: This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
  Transcript Variant: This variant (2) differs in the 5' and 3' UTRs and coding region compared to variant 1. The encoded isoform (2) has distinct N- and C-termini and is shorter than isoform 1.