Calcitonin receptor (CALCR) (NM_001164737) Human Untagged Clone

CAT#: SC327054

Reviews ()
Write a review

CALCR (untagged)-Human calcitonin receptor (CALCR) transcript variant 1



Reconstitution Protocol

USD 521.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CALCR
Synonyms CRT; CT-R; CTR; CTR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327054 representing NM_001164737.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAATTTTCTGGAGAGAAGATTAGTGGACAAAGAGATCTTCAAAAATCAAAAATGAGGTTCACATTT
ACAAGCCGGTGCTTGGCACTGTTTCTTCTTCTAAATCACCCAACCCCAATTCTTCCTGCCTTTTCAAAT
CAAACCTATCCAACAATAGAGCCCAAGCCATTTCTTTACGTCGTAGGACGAAAGAAGATGATGGATGCA
CAGTACAAATGCTATGACCGAATGCAGCAGTTACCCGCATACCAAGGAGAAGGTCCATATTGCAATCGC
ACCTGGGATGGATGGCTGTGCTGGGATGACACACCGGCTGGAGTATTGTCCTATCAGTTCTGCCCAGAT
TATTTTCCGGATTTTGATCCATCAGAAAAGGTTACAAAATACTGTGATGAAAAAGGTGTTTGGTTTAAA
CATCCTGAAAACAATCGAACCTGGTCCAACTATACTATGTGCAATGCTTTCACTCCTGAGAAACTGAAG
AATGCATATGTTCTGTACTATTTGGCTATTGTGGGTCATTCTTTGTCAATTTTCACCCTAGTGATTTCC
CTGGGGATTTTCGTGTTTTTCAGAAAATTGACAACTATTTTTCCTTTGAATTGGAAATATAGGAAGGCA
TTGAGCCTTGGCTGCCAAAGGGTAACCCTGCACAAGAACATGTTTCTTACTTACATTCTGAATTCTATG
ATTATCATCATCCACCTGGTTGAAGTAGTACCCAATGGAGAGCTCGTGCGAAGGGACCCGGTGAGCTGC
AAGATTTTGCATTTTTTCCACCAGTACATGATGGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATC
TATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTG
GGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAAC
TGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTC
AATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAA
TCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTC
GTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATT
CATTTCCAGGGCTTCTTTGTTGCGACCATCTACTGCTTCTGCAACAATGAGGTCCAAACCACCGTGAAG
CGCCAATGGGCCCAATTCAAAATTCAGTGGAACCAGCGTTGGGGGAGGCGCCCCTCCAACCGCTCTGCT
CGCGCTGCAGCCGCTGCTGCGGAGGCTGGCGACATCCCAATTTACATCTGCCATCAGGAGCTGAGGAAT
GAACCAGCCAACAACCAAGGCGAGGAGAGTGCTGAGATCATCCCTTTGAATATCATAGAGCAAGAGTCA
TCTGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164737
Insert Size 1527 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164737.1
RefSeq Size 3696 bp
RefSeq ORF 1527 bp
Locus ID 799
UniProt ID P30988
Cytogenetics 7q21.3
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 59.4 kDa
Gene Summary This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is more supported by conservation data.
Other products for "CALCR"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.