SVH (ARMC10) (NM_001161013) Human Untagged Clone

SKU
SC326791
ARMC10 (untagged)-Human armadillo repeat containing 10 (ARMC10) transcript variant F
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SVH
Synonyms PNAS-112; PNAS112; PSEC0198; SVH
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001161013, the custom clone sequence may differ by one or more nucleotides
ATGGGTGGCCCCCGGGGCGCGGGCTGGGTGGCGGCGGGCCTGCTGCTCGGCGCGGGCGCC
TGCTACTGCATTTACAGGCTGACCCGGGGTCGGCGGCGGGGCGACCGCGAGCTCGGGATA
CGCTCTTCGAAGTCCGCAGAAGACTTAACTGATGGTTCATATGATGATGTTCTAAATGCT
GAACAACTTCAGAAACTCCTTTACCTGCTGGAGTCAACGGAGGATCCTGTAATTATTGAA
AGAGCTTTGATTACTTTGGGTAACAATGCAGCCTTTTCAGTTAACCAAGCTATTATTCGT
GAATTGGGTGGTATTCCAATTGTTGCAAACAAAATCAACCATTCCAACCAGAGTATTAAA
GAGAAAGCTTTAAATGCACTAAATAACCTGAGTGTGAATGTTGAAAATCAAATCAAGATA
AAGGTGGATTCATCATTCCTTTCCCTTTATGACAGCCACGTAGCAAAGGAGATTCTTCTT
CGAGTACTTACGCTATTTCAGAATATAAAGAACTGCCTCAAAATAGAAGGCCATTTAGCT
GTGCAGCCTACTTTCACTGAAGGTTCATTGTTTTTCCTGTTACATGGAGAAGAATGTGCC
CAGAAAATAAGAGCTTTAGTTGATCACCATGATGCAGAGGTGAAGGAAAAGGTTGTAACA
ATAATACCCAAAATC
Restriction Sites Please inquire
ACCN NM_001161013
Insert Size 2297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001161013.1, NP_001154485.1
RefSeq Size 2297 bp
RefSeq ORF 678 bp
Locus ID 83787
UniProt ID Q8N2F6
Cytogenetics 7q22.1
Protein Families Transmembrane
Summary This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (F) lacks three in-frame exons in the coding region compared to variant A. This results in a shorter protein (isoform f) compared to isoform a.
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

SKU Description Size Price
RC228156 ARMC10 (Myc-DDK-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant F 10 ug
$330.00
RC228156L3 Lenti-ORF clone of ARMC10 (Myc-DDK-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant F 10 ug
$630.00
RC228156L4 Lenti-ORF clone of ARMC10 (mGFP-tagged)-Human armadillo repeat containing 10 (ARMC10), transcript variant F 10 ug
$630.00
RG228156 ARMC10 (tGFP-tagged) - Human armadillo repeat containing 10 (ARMC10), transcript variant F 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.