PDK3 (NM_001142386) Human Untagged Clone
SKU
SC325896
PDK3 (untagged)-Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PDK3 |
Synonyms | CMTX6; GS1-358P8.4 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_001142386 edited
ATGCGGCTGTTCCGGTGGCTGCTGAAGCAGCCGGTGCCCAAGCAGATCGAGCGCTACTCG CGCTTTTCGCCGTCGCCGCTCTCCATCAAACAATTCCTGGACTTCGGGAGAGATAATGCA TGTGAGAAAACTTCATATATGTTTCTACGAAAGGAACTTCCTGTGCGGCTGGCTAACACA ATGAGAGAAGTTAATCTTCTGCCGGATAATTTACTTAACCGCCCTTCAGTGGGATTGGTT CAGAGTTGGTATATGCAGAGTTTTCTTGAACTTTTAGAATATGAAAATAAGAGCCCTGAG GATCCACAGGTCTTGGATAACTTTCTACAAGTTCTGATTAAAGTCAGAAATAGACACAAT GATGTGGTTCCTACAATGGCACAAGGAGTGATTGAATACAAGGAGAAGTTTGGGTTTGAT CCTTTCATTAGCACTAACATCCAATATTTTCTGGATCGGTTTTATACCAACCGCATCTCT TTCCGCATGCTTATTAATCAGCACACACTTCTGTTTGGGGGTGACACTAATCCTGTTCAT CCTAAACACATAGGAAGTATCGATCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCA TATGAAACAGCCAAGATGCTGTGTGAACAGTATTACCTGGTAGCTCCAGAGCTGGAAGTT GAAGAATTCAATGCCAAAGCGCCAGACAAACCTATTCAGGTGGTTTATGTGCCCTCACAT CTGTTTCATATGCTATTTGAGTTGTTCAAGAACTCAATGAGAGCGACAGTTGAACTCTAT GAAGACAGAAAAGAGGGCTACCCTGCTGTTAAAACCCTCGTTACTTTGGGTAAAGAAGAC TTATCCATTAAGATCAGTGACCTAGGTGGTGGTGTCCCACTTCGAAAAATAGATCGTCTT TTTAACTACATGTATTCTACTGCTCCTAGACCCAGCCTGGAGCCTACCAGAGCTGCCCCT TTGGCTGGATTTGGTTATGGTTTGCCAATTTCCCGTCTGTATGCTAGATATTTTCAAGGA GATCTGAAACTGTATTCCATGGAAGGAGTGGGTACTGATGCTGTCATTTATTTGAAGGCT CTTTCAAGTGAGTCATTTGAGAGACTTCCAGTTTTTAATAAGTCCGCATGGCGCCATTAC AAGACCACGCCTGAAGCCGATGATTGGAGCAATCCCAGCAGTGAACCCAGGGATGCTTCA AAATACAAAGCAAAACAAGACAAGATCAAGACTAATAGAACTTTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001142386 |
Insert Size | 2300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001142386.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001142386.1, NP_001135858.1 |
RefSeq Size | 2162 bp |
RefSeq ORF | 1248 bp |
Locus ID | 5165 |
UniProt ID | Q15120 |
Cytogenetics | Xp22.11 |
Protein Families | Druggable Genome, Protein Kinase |
Summary | The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC227065 | PDK3 (Myc-DDK-tagged)-Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$457.00
|
|
RC227065L3 | Lenti-ORF clone of PDK3 (Myc-DDK-tagged)-Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$757.00
|
|
RC227065L4 | Lenti-ORF clone of PDK3 (mGFP-tagged)-Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$757.00
|
|
RG227065 | PDK3 (tGFP-tagged) - Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.