TSH Receptor (TSHR) (NM_001142626) Human Untagged Clone

SKU
SC325694
TSHR (untagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 3
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TSH Receptor
Synonyms CHNG1; hTSHR-I; LGR3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001142626 edited
ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGC
GGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACC
TGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATT
GAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGA
ATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTG
AGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGAT
GCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATG
TTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGAC
AACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTG
ACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACA
AAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCA
TTTGGAGGAGTATACAGTGGACCAAGCTTGCTGGTAGAAAATGTTGCTGTCTCGGGTAAA
GGCTTCTGCAAGTCCCTCTTTTCCTGGCTGTATAGGCTACCTCTTGGAAGAAAGTCCTTG
TCCTTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA
Restriction Sites Please inquire
ACCN NM_001142626
Insert Size 1200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142626.1, NP_001136098.1
RefSeq Size 1246 bp
RefSeq ORF 825 bp
Locus ID 7253
UniProt ID P16473
Cytogenetics 14q31.1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Autoimmune thyroid disease, Neuroactive ligand-receptor interaction
Summary The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence and uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus and contains an alternate internal segment compared to isoform 1.
Write Your Own Review
You're reviewing:TSH Receptor (TSHR) (NM_001142626) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226653 TSHR (Myc-DDK-tagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 3 10 ug
$450.00
RC226653L3 Lenti ORF clone of Human thyroid stimulating hormone receptor (TSHR), transcript variant 3, Myc-DDK-tagged 10 ug
$750.00
RC226653L4 Lenti ORF clone of Human thyroid stimulating hormone receptor (TSHR), transcript variant 3, mGFP tagged 10 ug
$750.00
RG226653 TSHR (tGFP-tagged) - Human thyroid stimulating hormone receptor (TSHR), transcript variant 3 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.