SIRT1 (NM_001142498) Human Untagged Clone

CAT#: SC325096

SIRT1 (untagged)-Human sirtuin 1 (SIRT1), transcript variant 2

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SIRT1 (NM_001142498) Human Untagged Clone
Symbol SIRT1
Synonyms SIR2; SIR2alpha; SIR2L1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001142498 edited
ATGTTTGATATTGAATATTTCAGAAAAGATCCAAGACCATTCTTCAAGTTTGCAAAGGAA
ATATATCCTGGACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAG
GAAGGAAAACTACTTCGCAACTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGA
ATCCAAAGGATAATTCAGTGTCATGGTTCCTTTGCAACAGCATCTTGCCTGATTTGTAAA
TACAAAGTTGACTGTGAAGCTGTACGAGGAGATATTTTTAATCAGGTAGTTCCTCGATGT
CCTAGGTGCCCAGCTGATGAACCGCTTGCTATCATGAAACCAGAGATTGTGTTTTTTGGT
GAAAATTTACCAGAACAGTTTCATAGAGCCATGAAGTATGACAAAGATGAAGTTGACCTC
CTCATTGTTATTGGGTCTTCCCTCAAAGTAAGACCAGTAGCACTAATTCCAAGTTCCATA
CCCCATGAAGTGCCTCAGATATTAATTAATAGAGAACCTTTGCCTCATCTGCATTTTGAT
GTAGAGCTTCTTGGAGACTGTGATGTCATAATTAATGAATTGTGTCATAGGTTAGGT:GG
TGAATATGCCAAACTTTGCTGTAACCCTGTAAAGCTTTCAGAAATTACTGAAAAACCTCC
ACGAACACAAAAAGAATTGGCTTATTTGTCAGAGTTGCCACCCACACCTCTTCATGTTTC
AGAAGACTCAAGTTCACCAGAAAGAACTTCACCACCAGATTCTTCAGTGATTGTCACACT
TTTAGACCAAGCAGCTAAGAGTAATGATGATTTAGATGTGTCTGAATCAAAAGGTTGTAT
GGAAGAAAAACCACAGGAAGTACAAACTTCTAGGAATGTTGAAAGTATTGCTGAACAGAT
GGAAAATCCGGATTTGAAGAATGTTGGTTCTAGTACTGGGGAGAAAAATGAAAGAACTTC
AGTGGCTGGAACAGTGAGAAAATGCTGGCCTAATAGAGTGGCAAAGGAGCAGATTAGTAG
GCGGCTTGATGGTAATCAGTATCTGTTTTTGCCACCAAATCGTTACATTTTCCATGGCGC
TGAGGTATATTCAGACTCTGAAGATGACGTCTTATCCTCTAGTTCTTGTGGCAGTAACAG
TGATAGTGGGACATGCCAGAGTCCAAGTTTAGAAGAACCCATGGAGGATGAAAGTGAAAT
TGAAGAATTCTACAATGGCTTAGAAGATGAGCCTGATGTTCCAGAGAGAGCTGGAGGAGC
TGGATTTGGGACTGATGGAGATGATCAAGAGGCAATTAATGAAGCTATATCTGTGAAACA
GGAAGTAACAGACATGAACTATCCATCAAACAAATCATAG
Tag Tag Free
ACCN NM_001142498
ORF Size 1359 bp
Insert Size 3600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001142498.1, NP_001135970
RefSeq Size 3604
RefSeq ORF 1359
Locus ID 23411
Cytogenetics 10q21.3
Protein Families Stem cell - Pluripotency, Transcription Factors, Druggable Genome
Gene Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008].
Transcript Variant: This variant (2) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform b has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.